Journal: bioRxiv

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.1101/2022.07.13.499814

Figure Lengend Snippet: a. Schematics of CRISPRi transcription repressor domains and general lentiviral expression construct used for all CRISPRi effectors. b. Experimental design to test effects of stable expression of each CRISPRi effector on growth and transcription in K562 cells. c. Growth defects of effector-expressing cells, measured as the log 2 ratio of mCherry-negative (effector-expressing) to mCherry-positive (not effector-expressing) cells in each well. mCherry levels were measured for 19 days after pooling cells. Data represent mean ± SD from three independent transductions of expression constructs. p -values are from an unpaired two-tailed t-test comparing D19 values for each sample to the D19 value for the “no plasmid” sample. Average percent growth defect per day is the log 2 D19 value divided by the number of days, multiplied by 100 for a percent value. d. Clustered heatmap of correlation of transcript counts from K562 cells expressing indicated CRISPRi effectors or a GFP control. Correlations across samples were calculated using normalized counts (reads per million) for all genes with mean normalized count >1 and then clustered using the Ward variance minimization algorithm implemented in scipy. r 2 is squared Pearson correlation. Data represent three independent transductions of expression constructs. e. Number of differentially expressed genes ( p < 0.05) for cells expressing each effector versus cells expressing GFP only. p -values were calculated using a Wald test and corrected for multiple hypothesis testing as implemented in DeSeq2. See also .

Article Snippet: A modified CROP-seq sgRNA lentiviral expression vector (pJR107) was derived from the parental vector pBA950 ( https://www.addgene.org/122239/ ) by incorporating a GFP fluorescent marker and a UCOE element upstream of the EF1alpha promoter to prevent marker silencing. sgRNA targeting sequences were appended with flanking sequence, BstX1/BlpI overhangs, and PCR adapters.

Techniques: Expressing, Construct, Two Tailed Test, Plasmid Preparation

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 1. Ablation of Nck (noncatalytic region of tyrosine kinase) 1 and Nck2 adaptor proteins reduces shear stress– induced endothelial permeability. A, Representative blots showing the efficiency of the knocking down of Nck1/2 in human aortic endothelial cells (HAECs) after Nck1/2 short hairpin RNA (shRNA) or scrambled shRNA control transduction. B and C, PECAM-1 (platelet endothelial cell adhesion molecule-1; white)/ß-catenin (red)–stained cells showing paracellular formation after oscillatory shear stress (OSS; ±5 dynes/cm2 with 1 dyne/cm2 forward flow) exposure. Images in the boxes indicate areas of higher magnifications, whereas areas in the dashed boxes indicate lower magnifications. Data analyzed by Kruskal-Wallis test (*P=0.03). White arrowheads indicate paracellular pores. D/E, Nck1/2 knocking down prevents flow-induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin). Images analyzed using NIS-Elements software. Scale bars=50-100 μm. Data are from n=4 independent experiments. Data are reported using box and whisker plots and analyzed by 2-way ANOVA and Bonferroni posttest (***P<0.001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Permeability, shRNA, Control, Transduction, Staining, Software, Whisker Assay

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 2. Deletion of Nck 1 but not Nck2 adaptor protein blunts shear stress–induced endothelial permeability. A, Representative blots showing the efficiency of the knocking down of Nck1/2 in human aortic endothelial cells (HAECs) after Nck1 short hairpin RNA (shRNA), Nck2 shRNA, or scrambled shRNA control transduction. B and C, PECAM-1 (platelet endothelial cell adhesion molecule-1; white)/ß-catenin (red)–stained cells showing paracellular formation (white arrowheads) after oscillatory shear stress (OSS) exposure. D and E, Nck1 but not Nck2 knocking down prevents flow- induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin). Images were analyzed using NIS- Elements software. Scale bars=50 to 100 μm. Data are from n=4 and analyzed as mean±SEM by 2-way ANOVA and Bonferroni posttest (*P<0.05, **P<0.01, ***P<0.001). Images in the boxes indicate areas of higher magnifications, whereas areas in the dashed boxes indicate lower magnifications.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Permeability, shRNA, Control, Transduction, Staining, Software

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 3. Conditional endothelial deletion of Nck (noncatalytic region of tyrosine kinase) 1 but not Nck2 blunts partial carotid ligation–induced permeability. A, Schematic of targeting strategy to construct Nck1 fl/fl mice. Nucleotide substitutions were made in exon 2. Embryonic stem cells transfected with the targeting constructs were screened for homologous recombination by polymerase chain reaction (PCR). PCR showing heterozygous Nck1 fl/+ and homozygous Nck1 fl/fl mice with the expected products at 490 bp (targeted alleles) and wild-type (Nck1+/+) at 377 bp. B, Pulmonary endothelial cells isolated from different experimental groups after tamoxifen injection and 2 weeks’ recovery, Nck1 and Nck2 expression were assessed by immunoblotting n=2 per group. C, Schematic of the study in which 4 groups of mice were subjected to the ligation surgery as indicated animal genotypes and time of surgery. D, Nck1 but not Nck2 knockout mice showed less Evans blue extravasation and (E) fluorescein isothiocyanate (FITC)-dextran in ng/μL after ligation, n=5 or 6 per group. Data are expressed as mean±SEM and analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05, **P<0.01) cKO indicates conditional knockouts; M, marker; Neo, neomycin; SDA, self-deletion anchor site.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Ligation, Permeability, Construct, Transfection, Homologous Recombination, Polymerase Chain Reaction, Isolation, Injection, Expressing, Western Blot, Knock-Out, Marker

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 4. SH3 domains of Nck (noncatalytic region of tyrosine kinase) 1 are essential for flow-induced endothelial permeability. A, Schematic showing the domain structure of Nck1 and Nck2 and 2 chimera of Nck1 SH2/SH3 and Nck1 SH3/Nck2 SH2. B, Western blot analysis showing comparable Nck1/2 re-expression following transduction of constructs in (A) in Nck1/2 double knockout (DKO) cells. C and D, Permeability of endothelial cells after oscillatory shear stress (OSS) as assessed by streptavidin-biotinylated gelatin trapping assay. Data are analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05; ns, nonsignificant, from n=4). E, Schematic diagram suggesting that Nck1/2 bind to PECAM-1 (platelet endothelial cell adhesion molecule-1) in response to shear stress, but only Nck1 through its SH3 domains regulates the permeability.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Permeability, Western Blot, Expressing, Transduction, Construct, Double Knockout, Shear

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 5. Nck (noncatalytic region of tyrosine kinase) 1 and Nck2 bind to PECAM-1 (platelet endothelial cell adhesion molecule-1) in response to shear stress but Nck1 is required for bridging PAK (p21-activated kinase) 2/PECAM-1 and activation. A, Immunoblotting showing PECAM-1 coimmunoprecipitations and confirms the interactions with Nck1 and Nck2 are shear stress dependent. B, Graphical representation of the levels of Nck1 in PECAM-1 coimmunopreciptation showing statistical significance. C, Immunofluorescence staining to PECAM-1 (red) and Nck1/2 (green) after shears stress. Scale bar=50 μm. D, phospho-PAK2 is detected in PECAM-1 coimmunopreciptation and (E) PAK membrane translocation and PECAM-1 binding is enhanced by shear stress and impaired after knocking down of Nck1. F and G, PAK2 activation as assessed by phosphorylation is downregulated by Nck1 ablation but not by Nck2 deletion. Western blots are from n=4 independent experiments. Data are mean±SEM analyzed by either 1-way ANOVA and Tukey posttest or 2-way ANOVA and Bonferroni posttest (*P<0.05, ****P<0.0001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Activation Assay, Western Blot, Immunofluorescence, Staining, Membrane, Translocation Assay, Binding Assay, Phospho-proteomics

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 6. Nck (noncatalytic region of tyrosine kinase) 1 first SH3 domain regulates PAK2 (p21-activated kinase 2)-induced endothelial permeability. A, Schematic of Nck1 point mutations in each of the SH3 domains and the nomenclature used to inactivation of SH3 domains. B, Lysates from human aortic endothelial cells (HAECs) transiently transfected with Nck1 variants with inactivated SH3 domains. C and D, Flow- induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin) Images analyzed using NIS-Elements software from n=4. Scale bar=200 μm. Data were reported as box and whiskers with scatter plots and analyzed by Kruskal–Wallis test (*P<0.05,**P<0.01, ***P<0.001). E, Lysates and graphical quantifications from HAECs Nck1/2 double knockout (DKO) transiently transfected with either hNck1 or Nck1 SH3.1* and were immunoprecipitated for PECAM-1 (platelet endothelial cell adhesion molecule-1). Blotted for phospho- PAK2 S141. F, HAECs Nck1/2 DKO either transfected with hNck1 or Nck1 SH3.1* were lyzed after shear stress exposure (0–30 minutes) and immunoblotted for phospho-PAK2 S141 and GAPDH served as a loading control. Data are from n=3-4, expressed as mean±SEM, and analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05,****P<0.0001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Permeability, Transfection, Software, Double Knockout, Immunoprecipitation, Shear, Control